GAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAATGTTCTTGTTAACAACTAAACGAACA

ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCC

TGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTC

AGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAG

AGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGG

CTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTA

AAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAA

AGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGA

AGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTA

AGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATA

GGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGG

TTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATG

GAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTA

GAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAA

CTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA

ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACT

AAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGC

TCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGA

ATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAA

CCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTG

TTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTT

CTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTC

AATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATT

TGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTT

CTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAAC

TGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGT

TTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTG

CAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATT

GCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTAC

TATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTG

ATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATA

GCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGA

TTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTAC

TTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGA

GACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATA

CACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTG

CTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCC

AACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGA

TGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTG

TTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTT

CAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTAC

TAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCC

CTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCT

CCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGT

AACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAA

TAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATAT

TTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAA

AGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATG

AGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATT

ATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGA

AGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAATGTTCTTGTTAACAACTAAACGAACAA

TGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTG

Basic facts regarding SARS-CoV-2, the virus causing the current pandemic

? The name of this virus (which is an organism) is SARS-CoV-2

o SARS-CoV-2 stands for ‘severe acute respiratory syndrome (SARS)-associated coronavirus-2’

? Note: the ‘2’ at name’s end helps to distinguish it from a related virus named SARS-CoV (or

SARS-CoV-1) that caused an outbreak in 2002-2003 (~ 800 confirmed cases, mostly in China).

? The name of the disease that SARS-CoV-2 causes is COVID-19, which stands for ‘Coronavirus disease 2019’. The

symptoms of the disease vary widely among individuals – some have no symptoms (=asymptomatic), while

others have mild, moderate or serious symptoms which generally involve the respiratory tract.

? SARS-CoV-2 is a viral species within the genus Coronavirus. Since there are other species in this genus, many

different Coronaviruses exist. Some Coronaviruses infect humans and can cause serious illness (e.g. SARS-CoV-2,

SARS-CoV-1, and MERS [Middle East Respiratory Syndrome Coronavirus]), whereas other human Coronaviruses

can cause the common cold, which is generally a mild illness (these ‘common’ Coronaviruses are named 229E,

NL63, OC43, and HKU1). Other Coronaviruses aren’t known to infect humans but rather infect other animals.

Often, in the press or in casual conversation, SARS-CoV-2 is referred to as ‘Coronavirus’ or ‘COVID-19’, which is

fine…but, as students taking a college biology course, you should know that there are many different

Coronaviruses, the proper name of this specific one is SARS-CoV-2 and the disease it causes is COVID-19.

? All viruses, including the Coronaviruses, are NOT cells and they can only reproduce when they infect a specific

host cell. Viruses are not considered cells since they lack several structures that all cells have (e.g., ribosomes)

and lack several processes that all cells perform (e.g., make ATP).

? All Coronaviruses use RNA as their hereditary material (= genome) instead of having a DNA genome. You should

think this is weird….remember, the genomes of all cells consists of DNA (not RNA). The RNA genome of a

Coronavirus is stabilized by attached proteins called nucleocapsids (labeled ‘N protein’ below) and is surrounded

by a phospholipid coat called an envelope (in red below). Interestingly, the virus steals these phospholipids

from the host cell it infects!

Source: Wikipedia

Sticking out from the phospholipid envelope, like rays of the sun, are a series of surface glycoproteins (proteins with

attached sugars) termed spikes (in pink above). ‘Corona’ is a Latin term meaning ‘crown’ – makes sense, right? This

viral genus was named Coronavirus since the glycoprotein spikes radiating from the viruses’ surface resemble the spikes

radiating from a crown. Most vaccines candidates currently in clinical trials are designed to expose the body to either

the SARS-CoV-2 spike or a just portion of the spike (neither of which, on their own, are infectious?). If successful, the

spike-based vaccine would ‘train’ the body, without causing disease, to generate neutralizing antibodies and long-lived

immune cells that would recognize the real SARS-CoV-2 upon future infections and target the virus for destruction.

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 1/9

Resources and Instructions for Exercise 8 Lab
Completion Activities

Lab Comple?on Ac?vi?es and Resources for Exercise 8

Instruc?ons:

This page is meant to GUIDE your work through the ac?vi?es in the lab manual and IS NOT

A SUBSTITUTE FOR READING THE LAB MANUAL. O?en, student ques?ons can be

answered by reading the corresponding sec?ons in the lab manual.

Prelab Review

Interact with the following video to review the correct answers for the prelab ques?ons.

Exercise 8 has A LOT of content. It is cri?cal you understand this content as much as

possible before moving on to the Ex 8 in-class ac?vi?es.

Note: this video discusses prelab ques?ons #3-4, which we did not ask you to address

Spring 2022 – Principles of Biology I Lab (BIOL-1107… PP

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 2/9

Part one: Determining the structure of a protein-encoding gene
(page 277-281 in the lab manual)

In Part 1 of your manual, read the content and do your best to fill in answers for each

ques?on in your manual. A?er comple?ng these ques?ons, interact with the following

video that provides assistance with Part 1. Avoid simply watching the video without first

working through Part 1. If you invest the ?me to try these ques?ons to the best of your

ability, you’ll learn much more from the video feedback.

Part two: How to iden?fy an Open Reading Frame (ORF) (pages
282-286 of the lab manual)

In Part 2 of your manual, read the content and do your best to fill in answers for each

ques?on and complete Table 8.1 on p. 285

Hints: instruc?ons are at bo?om of p. 284. Also, in Table 8.1, the +3 column has been filled

in to serve as an example. Review the instruc?ons and the example carefully. This should

help you figure out how to complete the rest of the table.

A?er you complete these ques?ons and Table 8.1, please interact with the following video

that provides assistance with Part 2.

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 3/9

Part three: Iden?fying ORFs within the SARS-CoV-2 genome
(follow steps outlined below)

Now, you’re going to learn how to analyze an organism’s genome sequence to find poten?al

genes (= ORFs) that encode for proteins.

Normally, you’d perform Parts 3-5 step by step as wri?en in the manual to analyze a type of

Wolbachia that causes elephan?asis.

However, we thought it would be more fun for you to instead analyze the coronavirus

causing the current pandemic.

Therefore, we’re going to deviate a bit from the manual for the rest of this exercise. Follow

the instruc?ons below, NOT the instruc?ons in your lab manual.

Begin by ensuring you’re informed about the virus you’re about to analyze. Read the

Background facts SARS-CoV-2 document included in the Items you need to

download to complete this module

Now, conduct a literature search:

Pretend you saw a tweet about a peer-reviewed journal ar?cle repor?ng on

the new coronavirus and human respiratory disease.

The ar?cle was published in 2020 in the scien?fic journal ‘Nature’ and the

name of the first author is Fan Wu.

Fear not! You can find the full ar?cle using skills developed in Exercises 1 and

3 to search a scien?fic literature database (links are below).

Hint: due to the traits of this ar?cle, one of these databases is op?mal.

Click on the database you should use to conduct this search and find this

research ar?cle. Note: due to the traits of this ar?cle, one of these 2

databases is op?mal. Click on the database you should use to conduct this

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 4/9

search and find this research ar?cle

Google Scholar

PubMed

Once you have found this ar?cle, click on the ‘free full text link’ (top

right), download the PDF of the ar?cle, and save it to your desktop.

Now, if your haven’t already, read Part 3 of your lab manual star?ng on p. 288 (you

may skip p. 286-287 in Part 3 of your manual since it contains background useful if

we were going to analyze Wolbachia in this lab [which we’re not]).

Keep in mind that you will use the same skills to analyze the SARS-CoV-2

genome as you would have used to analyze a Wolbachia genome. You are

learning transferable skills in this lab that you could use to find ORFs in any

genome

Next, read Part 3 of your lab manual beginning on p. 288 (skip p. 286-287 since it

pertains to Wolbachia – not our focus this week).

Keep in mind that you will use the same skills to analyze the SARS-CoV-2

genome as you would have used to analyze a Wolbachia genome.

You are learning transferable skills in this lab that you could use to find ORFs

in any genome

Next, open the PDF of the Fan Wu et al. 2020 ar?cle you just downloaded.

In the main body of the paper, these authors discuss the phylogeny

(evolu?onary history) of SARS-COV-2 (they called it WHCV since this ar?cle

was published very early in 2020, before the virus was officially named SARS-

CoV-2).

In this ar?cle, the researchers conclude that this novel virus is most closely

related to a group of SARS-like coronaviruses found in bats.

You may read the full ar?cle if you’d like, but for this exercise, we’re going to

focus on the SARS-COV-2 genome and find open reading frames (ORFs).

Think back to Exercise 1. In which sec?on of the ar?cle would you expect to

find informa?on on how the authors ran their experiments and analyses?

Scroll to that sec?on of the paper and look for informa?on on ‘Data

Availability’.

Once you find this sec?on, click on the WHCV complete genome sequence

accession number (hint: the accession number starts with MN).

This will bring you to an NCBI webpage that should look like the screenshot

shown below.

Cli k th ?tl (‘S t i t d i 2 i l t

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 5/9

Click on the ?tle (‘Severe acute respiratory syndrome coronavirus 2 isolate

Wuhan-Hu-1, complete genome’) to access the genome sequence.

Follow the direc?ons in the following video for the next few steps.

Pause as needed to perform the tasks and return here if you get stuck (note: the link

to the ‘ORF Finder’ so?ware, men?oned in the video, is below).

The next video refers to page numbers in an old edi?on of the manual. The

notes below direct you to the correct page numbers in your current edi?on.

As the video covers using ORF Finder, begin reading on p. 288 in your

manual and specifically follow steps #2-6 (p. 288-289) to run ORF

Finder.

During the video, you’ll be asked to answer ques?ons to analyze the

ORF Finder results. Answer ques?ons #7a-d (p. 289) directly in your

manual.

Part 3 ends with step #8 on p. 289 which directs you to NOT

close your ORF Finder window. You’ll con?nue the analysis from this

window in Part 4.

Notes regarding the content in Part 3:

As you watch the next video, no?ce that the SARS-CoV-2 genome is

depicted as containing T’s. This should seem strange since T’s are in

DNA, yet you learned earlier that all Coronaviruses (including SARS-

CoV-2) have an RNA genome (recall: RNA has U’s in place of T’s) – how

can this be?

For simplicity, databases like GenBank represent all genome

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 6/9

sequences (even viral RNA genomes) using DNA nucleo?des – it

makes it easier to for scien?sts compare genomes from different

organisms (say cells vs. an RNA virus) if they are all displayed

using the same ‘language’. You see T’s in the genome sequence

you copied and pasted, but know that in the real SARS-CoV-2

RNA genome, there exists U’s in place of the T’s.

Link to ‘ORF Finder’ so?ware

Part four: Using BLAST to predict the func?on of an ORF (follow
steps outlined below)

Congratula?ons…you have found an ORF within the SARS-COV-2 genome! Next, let’s

determine whether this ORF is a gene that likely codes for a func?onal protein.

Follow the direc?ons in the video below for the next few steps.

Pause as needed to perform the tasks and return to this document for guidance if

you get stuck.

The next video refers to page numbers in an old edi?on of the manual. The notes

below direct you to the correct page numbers in your current edi?on.

Start by reading p. 290 of your lab manual (all text before step 1). This

explains what the so?ware program BLAST actually does.

As you follow the next video to run the BLAST program, you

will perform steps #1a, 1b, and 1c on p. 290-291 in your lab manual

Be sure to answer the ques?ons on pages 291-294 in your lab manual while

you work (skip ques?on 4 on page 291).

N ? h f i BLAST l i h

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 7/9

Note: over ?me, the output for a given BLAST analysis can change

somewhat as new sequences are added to the database, exis?ng

sequences are edited, and as search algorithms and graphics are

altered. The video below describes BLAST output in which the top hit

was 100% iden?cal to our query (input) sequence, meaning that BLAST

found the same sequence you copied from the Fan Wu 2020

publica?on in the GenBank database (and big surprise, it’s 100%

iden?cal to itself!). However, now when we BLAST the same query, no

sequence in the database is 100% iden?cal (though many are nearly so

at ~ 99.98%). Why is that? One possibility: the Fan Wu research group

iden?fied a minor error in the sequence they originally published (~1

amino acid change) and have recently fixed the sequence in the

database entry. Therefore, the sequence from the original publica?on

now doesn’t match it’s edited form in the database.

Part five: So, what does this protein do anyways? (follow steps
outlined below; this part does NOT involve the lab manual)

Now for the fun part. You have successfully iden?fied a viral gene we now know

codes for a polyprotein. Way to go!

What does the ‘poly’ in polyprotein make you think of? Many!

Researchers discovered this specific viral protein is the first one produced when a

host cell is infected and it is actually a chain of many proteins joined together.

Amazingly, two of the proteins within this polyprotein chain act like scissors and cut

the connec?ons between the different proteins in the chain.

This frees the individual proteins to fold independently so they can carry out their

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 8/9

dis?nct roles (func?ons). Let’s have a look at these proteins.

Follow the direc?ons in the video below.

Pause as needed to perform the tasks and return to this document for

guidance in the next few bullet points if you get stuck.

Periodically, the format/appearance of BLAST is changed and recently

minor changes were made from what you see in the video below.

During the video, you are directed to click on the ‘yellow link’ within

the ‘Graphic Summary’ tab of your BLAST output. Now, instead of the

yellow link (which is no longer present), a complicated, colorful figure

will appear that displays the ORF you’re analyzing. Click anywhere in

this figure (see screenshot below) and you’ll be directed to the correct

step.

Discussion Ques?ons (do NOT perform the discussion ques?ons

3/31/22, 9:22 PM Resources and Instructions for Exercise 8 Lab Completion Activities – Spring 2022 – Principles of Biology I Lab (BIOL-1107L-OF2)

https://georgiasouthern.desire2learn.com/d2l/le/content/689491/viewContent/9972096/View 9/9

Reflect in ePortfolio Download Print

Discussion Ques?ons (do NOT perform the discussion ques?ons
in the lab manual, instead follow the instruc?ons below)

To access the correct discussion ques?ons, download the discussion ques?ons file

You have viewed this topic

Last Visited Mar 30, 2022 6:04 PM

Activity Details