EXPERT SOLUTION: Discussion questions for Ex 8 (Note: these deviate from the manual) There are two parts to the

Discussion questions for Ex 8

(Note: these deviate from the manual)

There are two parts to these new discussion questions for Ex 8. In part 1, you’ll generate a short essay. In Part 2, you’ll perform ORF Finder and BLAST on a new sequence and answer 5 questions.

Both parts must be completed in full, represent your own work and be expressed using your own words. Insert all content into this MS Word document and upload saved document to Folio to the appropriate dropbox.


Part 1:

Directions: Within the ‘Lab Completion for Exercise 8’ Folio page under Discussion, choose the link to the excellent article entitled ‘NY Times article: Bad news wrapped in a protein’. This article describes various proteins encoded by the SARS-CoV-2 genome you’ve been analyzing.

· Choose one protein described in the NY Times article and write a 2 paragraph essay that has the following structure and content:

· the first paragraph (3-5 sentences) must state the name of the protein you chose and describe its function.

· the second paragraph (3-5 sentence) must describe a detail that you found most interesting about this week’s lab and briefly summarize why scientists rely on software like ORF Finder and BLAST. 

Type your 2 paragraph essay here (return to create more space, if needed):


Part 2:

Directions: Within the ‘Lab Completion for Exercise 8’ Folio page under Discussion, choose the link entitled ‘Genome sequence to analyze for discussion questions’. The file will open in a new window and contains sequence of a different section of the SARS-CoV-2 genome than the one you analyzed in parts 3-5. This section contains a different ORF which encodes for a different protein. 

· Copy the entire sequence. 

· Analyze this sequence using ORF Finder just as you did in Part three.  If you don’t remember how to do this, re-watch the video in Part 3.

· The link for ORF Finder is in the Discussion section of your Ex 8 Folio page. However, you could always Google the term ‘ORF Finder NCBI’ to locate the site containing this software.

· Answer the following four questions:

1. What is the reading frame (choose one: -1, -2, -3, +1, +2 or +3) of the 
largest
 open reading frame (ORF) within this sequence?

2. How many nucleotides (nt) are there in this ORF?

3. How many codons are there within this ORF?

4. How many amino acids are encoded by this ORF?

· Now, BLAST the amino acid sequence encoded by this ORF just as you did in Part four. Re-watch the video in part 4 if you don’t remember the steps.

· Remember, within the ORF Finder software, under the ‘BLAST database’ option, select “Non-redundant protein sequences (nr)” from the dropdown menu. 

· Then, choose the “BLAST” button (
NOT
 SmartBLAST). 

· Answer the following question:

5. Based on the BLAST results, list the name of the protein you predict this ORF encodes for.

GAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAATGTTCTTGTTAACAACTAAACGAACA

ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCC

TGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTC

AGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAG

AGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGG

CTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTA

AAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAA

AGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGA

AGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTA

AGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATA

GGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGG

TTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATG

GAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTA

GAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAA

CTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA

ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACT

AAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGC

TCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGA

ATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAA

CCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTG

TTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTT

CTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTC

AATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATT

TGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTT

CTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAAC

TGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGT

TTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTG

CAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATT

GCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTAC

TATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTG

ATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATA

GCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGA

TTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTAC

TTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGA

GACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATA

CACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTG

CTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCC

AACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGA

TGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTG

TTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTT

CAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTAC

TAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCC

CTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCT

CCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGT

AACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAA

TAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATAT

TTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAA

AGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATG

AGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATT

ATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGA

AGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAATGTTCTTGTTAACAACTAAACGAACAA

TGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTG

Basic facts regarding SARS-CoV-2, the virus causing the current pandemic

? The name of this virus (which is an organism) is SARS-CoV-2

o SARS-CoV-2 stands for ‘severe acute respiratory syndrome (SARS)-associated coronavirus-2’

? Note: the ‘2’ at name’s end helps to distinguish it from a related virus named SARS-CoV (or

SARS-CoV-1) that caused an outbreak in 2002-2003 (~ 800 confirmed cases, mostly in China).

? The name of the disease that SARS-CoV-2 causes is COVID-19, which stands for ‘Coronavirus disease 2019’. The

symptoms of the disease vary widely among individuals – some have no symptoms (=asymptomatic), while

others have mild, moderate or serious symptoms which generally involve the respiratory tract.

? SARS-CoV-2 is a viral species within the genus Coronavirus. Since there are other species in this genus, many

different Coronaviruses exist. Some Coronaviruses infect humans and can cause serious illness (e.g. SARS-CoV-2,

SARS-CoV-1, and MERS [Middle East Respiratory Syndrome Coronavirus]), whereas other human Coronaviruses

can cause the common cold, which is generally a mild illness (these ‘common’ Coronaviruses are named 229E,

NL63, OC43, and HKU1). Other Coronaviruses aren’t known to infect humans but rather infect other animals.

Often, in the press or in casual conversation, SARS-CoV-2 is referred to as ‘Coronavirus’ or ‘COVID-19’, which is

fine…but, as students taking a college biology course, you should know that there are many different

Coronaviruses, the proper name of this specific one is SARS-CoV-2 and the disease it causes is COVID-19.

? All viruses, including the Coronaviruses, are NOT cells and they can only reproduce when they infect a specific

host cell. Viruses are not considered cells since they lack several structures that all cells have (e.g., ribosomes)

and lack several processes that all cells perform (e.g., make ATP).

? All Coronaviruses use RNA as their hereditary material (= genome) instead of having a DNA genome. You should

think this is weird….remember, the genomes of all cells consists of DNA (not RNA). The RNA genome of a

Coronavirus is stabilized by attached proteins called nucleocapsids (labeled ‘N protein’ below) and is surrounded

by a phospholipid coat called an envelope (in red below). Interestingly, the virus steals these phospholipids

from the host cell it infects!

Source: Wikipedia

Sticking out from the phospholipid envelope, like rays of the sun, are a series of surface glycoproteins (proteins with

attached sugars) termed spikes (in pink above). ‘Corona’ is a Latin term meaning ‘crown’ – makes sense, right? This

viral genus was named Coronavirus since the glycoprotein spikes radiating from the viruses’ surface resemble the spikes

radiating from a crown. Most vaccines candidates currently in clinical trials are designed to expose the body to either

the SARS-CoV-2 spike or a just portion of the spike (neither of which, on their own, are infectious?). If successful, the

spike-based vaccine would ‘train’ the body, without causing disease, to generate neutralizing antibodies and long-lived

immune cells that would recognize the real SARS-CoV-2 upon future infections and target the virus for destruction.

Place your order
(550 words)

Approximate price: $22

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Our guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Read more

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Read more

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Read more

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Read more

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.

Read more